GENE INFORMATION FOR SPU_022817

Identification
    ID: SPU_022817
    Common Name: Sp-Alx1_1
    Synonyms: aristaless-like homeobox 1-like, Cart1/Alx3/Alx4 subfamily-like
    Family Member: homeobox
    Gene Model Check by: manual annotation
    Additional Evidence:
     
  • QPCR
  •  
  • PCR (5'RACE)
  •  
  • Library screens
  •  
  • Microarray hybridization
  •  
  • Whole mount in situ hybridization
    Ortholog/Homolog:  Not determined
Genomic Location
Expression
    Not Available
Functional Category
    Class Sub-Class Annotation Type
    TranscriptionFactor TranscriptionFactor_Homeo electronic annotation
Gene Ontology
Biological process
  • regulation of transcription, DNA-templated (GO:0006355)
  • (IEA)

    Molecular Function
  • DNA binding (GO:0003677)
  • (IEA)
  • sequence-specific DNA binding transcription factoractivity (GO:0003700)
  • (IEA)
  • sequence-specific DNA binding (GO:0043565)
  • (IEA)
    Sequence

      Gene Model Evidence CDS Exons Peptide All Sequences
      SPU_022817.1 (1) GLEAN prediction 669bp N/A 222aa display

      SPU_022817.2 (2) GLEAN prediction N/A 669bp N/A display

      SPU_022817.3a (3) RNAseq Transcriptome (WHL22.731056) N/A 5070bp 430aa display

      SPU_022817.3b (4) RNAseq Transcriptome (WHL22.731056) N/A 5169bp 454aa display

      +  Footnotes
      Strongylocentrotus purpuratus Genome Browser
    Reagents

      QPCR Primers 1 (Reference: 20181745)

        Forward: Spakx1 5'-CACCCGTAGAGGGCGCTATA-3'
        Reverse: Spakx1 5'-CACCCGTAGAGGGCGCTATA-3'

      QPCR Primers 2 (Reference: 26400092)

        Forward: Alx1 5'-CACCCGTAGAGGGCGCTATG-3'
        Reverse: Alx1 5'-TGCTGGAGTCTTGCGATTCG-3'

      Translation Block Morpholino 1 (Reference: 24496631)

        Sp-Alx1 TATTGAGTTAAGTCTCGGCACGACA

      Translation Block Morpholino 2 (Reference: 26400092)

        Alx-seed1 ACATCGCAGGCAAGACTCAATGGCT

      Translation Block Morpholino 3 (Reference: 26400092)

        Alx-seed2 ATCATGTCGTTGGCAAGATGAAAAT

    Comment
        This model has been integrated into SPU_025302, Sp-Alx1.
    References
      • Tu Q, Cameron RA, Worley KC, Gibbs RA, Davidson EH  (2012)  Gene structure in the sea urchin Strongylocentrotus purpuratus based on transcriptome analysis.  Genome Res  22(10)2079-87.  22709795
      • Sharma T, Ettensohn CA  (2010)  Activation of the skeletogenic gene regulatory network in the early sea urchin embryo.  Development  137(7)1149-57.  20181745
      • Wei Z, Angerer RC, Angerer LM  (2006)  A database of mRNA expression patterns for the sea urchin embryo.  Dev Biol  300(1)476-84.  17007833
      • Ettensohn CA, Illies MR, Oliveri P, De Jong DL  (2003)  Alx1, a member of the Cart1/Alx3/Alx4 subfamily of Paired-class homeodomain proteins, is an essential component of the gene network controlling skeletogenic fate specification in the sea urchin embryo.  Development  130(13)2917-28.  12756175
      • Howard-Ashby M, Materna SC, Brown CT, Chen L, Cameron RA, Davidson EH  (2006)  Identification and characterization of homeobox transcription factor genes in Strongylocentrotus purpuratus, and their expression in embryonic development.  Dev Biol  300(1)74-89.  17055477
      • Todgham AE, Hofmann GE  (2009)  Transcriptomic response of sea urchin larvae Strongylocentrotus purpuratus to CO2-driven seawater acidification.  J Exp Biol  212(Pt 16)2579-94.  19648403
      • Rafiq K, Shashikant T, McManus CJ, Ettensohn CA   (2014)   Genome-wide analysis of the skeletogenic gene regulatory network of sea urchins.   Development   141(4)950-61.  24496631
      • Yamazaki A, Kidachi Y, Yamaguchi M, Minokawa T  (2014)  Larval mesenchyme cell specification in the primitive echinoid occurs independently of the double-negative gate.  Development  141(13)2669-79.  24924196
      • Sun M, Cheng X, Socolar JE  (2014)  Regulatory logic and pattern formation in the early sea urchin embryo.  J Theor Biol  363C:80-92.  25093827
      • Sun Z, Ettensohn CA  (2014)  Signal-dependent regulation of the sea urchin skeletogenic gene regulatory network.  Gene Expr Patterns  16(2)93-103.  25460514
      • Gao F, Thompson JR, Petsios E, Erkenbrack E, Moats RA, Bottjer DJ, Davidson EH  (2015)  Juvenile skeletogenesis in anciently diverged sea urchin clades.  Dev Biol  none  25641694
      • Stepicheva NA, Song JL  (2015)  microRNA-31 modulates skeletal patterning in the sea urchin embryo.  Development  142(21)3769-80.  26400092