GENE INFORMATION FOR SPU_025302

Identification
    ID: SPU_025302
    Common Name: Sp-Alx1
    Synonyms: aristaless-like homeobox 1-like, Alx1(Cart1)/Alx3/Alx4 subfamily-like, Sp-Alx1_1
    Family Member: homeobox-PRD
    Gene Model Check by: manual annotation
    Additional Evidence:
     
  • QPCR
  •  
  • PCR (5'RACE)
  •  
  • Library screens
  •  
  • Microarray hybridization
  •  
  • Whole mount in situ hybridization
    Ortholog/Homolog:  Urchin-specific homolog of gene subfamily defined by Alx1 - ALX homeobox 1 [Mus musculus], Alx3 aristaless-like homeobox 3 [Mus musculus] and Alx4 - aristaless-like homeobox 4 [Mus musculus]
Genomic Location
Expression
Functional Category
    Class Sub-Class Annotation Type
    TranscriptionFactor TranscriptionFactor_Homeo electronic annotation
Gene Ontology
Biological process
  • regulation of transcription, DNA-templated (GO:0006355)
  • (IEA)

    Cellular Component
  • nucleus (GO:0005634)
  • (IEA)

    Molecular Function
  • DNA binding (GO:0003677)
  • (IEA)
  • sequence-specific DNA binding transcription factoractivity (GO:0003700)
  • (IEA)
  • sequence-specific DNA binding (GO:0043565)
  • (IEA)
    Sequence

      Gene Model Evidence CDS Exons Peptide All Sequences
      SPU_025302.1 (1) GLEAN prediction 1293bp N/A 430aa display

      SPU_025302.2 (2) GLEAN prediction N/A 3957bp N/A display

      SPU_025302.3a (3) RNAseq Transcriptome (WHL22.731056) N/A 5070bp 430aa display

      SPU_025302.3b (4) RNAseq Transcriptome (WHL22.731056) N/A 5169bp 454aa display

      +  Footnotes
      Strongylocentrotus purpuratus Genome Browser
    Reagents

      QPCR Primers 1 (Reference: 21623371)

        Forward: alx1 5'-CAGTGCAGCTTTACGTGGAC-3'
        Reverse: alx1 5'-TTAAGTCTCGGCACGACAAA-3'

      QPCR Primers 2 (Reference: 20181745)

        Forward: Sp-Alx1 5'-CACCCGTAGAGGGCGCTATA-3'
        Reverse: Sp-Alx1 5'-TGCTGGAGTCTTGCGATTCG-3'

      QPCR Primers 3 (Reference: 20181745)

        Forward: Spakx1 5'-CACCCGTAGAGGGCGCTATA-3'
        Reverse: Spakx1 5'-CACCCGTAGAGGGCGCTATA-3'

      QPCR Primers 4 (Reference: 26400092)

        Forward: Alx1 5'-CACCCGTAGAGGGCGCTATG-3'
        Reverse: Alx1 5'-TGCTGGAGTCTTGCGATTCG-3'

      Translation Block Morpholino 1 (Reference: 12836701)

        SpAlx1 TATTGAGTTAAGTCTCGGCACGACA

      Translation Block Morpholino 2 (Reference: 24496631)

        Sp-Alx1 TATTGAGTTAAGTCTCGGCACGACA

      Translation Block Morpholino 3 (Reference: 26400092)

        Alx-seed1 ACATCGCAGGCAAGACTCAATGGCT

      Translation Block Morpholino 4 (Reference: 26400092)

        Alx-seed2 ATCATGTCGTTGGCAAGATGAAAAT

    Comment
        Originally described and designated as Alx1 in PMID: 12756175. There is another member of the Alx subfamily, Sp-Alx4 (SPU_022816), also on Spur3.1 Scaffold881. Identical numbering of Alx subfamily members in S. purpuratus and vertebrates does not imply one to one orthology.
    References
      • Tu Q, Cameron RA, Worley KC, Gibbs RA, Davidson EH  (2012)  Gene structure in the sea urchin Strongylocentrotus purpuratus based on transcriptome analysis.  Genome Res  22(10)2079-87.  22709795
      • Sharma T, Ettensohn CA  (2010)  Activation of the skeletogenic gene regulatory network in the early sea urchin embryo.  Development  137(7)1149-57.  20181745
      • Annunziata R, Perillo M, Andrikou C, Cole AG, Martinez P, Arnone MI  (2013)  Pattern and process during sea urchin gut morphogenesis: The regulatory landscape.  Genesis  NA  24376127
      • Ettensohn CA, Illies MR, Oliveri P, De Jong DL  (2003)  Alx1, a member of the Cart1/Alx3/Alx4 subfamily of Paired-class homeodomain proteins, is an essential component of the gene network controlling skeletogenic fate specification in the sea urchin embryo.  Development  130(13)2917-28.  12756175
      • Wei Z, Angerer RC, Angerer LM  (2006)  A database of mRNA expression patterns for the sea urchin embryo.  Dev Biol  300(1)476-84.  17007833
      • Peter IS, Davidson EH  (2011)  A gene regulatory network controlling the embryonic specification of endoderm.  Nature  474(7353)635-9.  21623371
      • Damle S, Davidson EH  (2011)  Precise cis-regulatory control of spatial and temporal expression of the alx-1 gene in the skeletogenic lineage of s. purpuratus.  Dev Biol  357(2)505-17.  21723273
      • Rafiq K, Shashikant T, McManus CJ, Ettensohn CA   (2014)   Genome-wide analysis of the skeletogenic gene regulatory network of sea urchins.   Development   141(4)950-61.  24496631
      • Yamazaki A, Kidachi Y, Yamaguchi M, Minokawa T  (2014)  Larval mesenchyme cell specification in the primitive echinoid occurs independently of the double-negative gate.  Development  141(13)2669-79.  24924196
      • Sun M, Cheng X, Socolar JE  (2014)  Regulatory logic and pattern formation in the early sea urchin embryo.  J Theor Biol  363C:80-92.  25093827
      • Sun Z, Ettensohn CA  (2014)  Signal-dependent regulation of the sea urchin skeletogenic gene regulatory network.  Gene Expr Patterns  16(2)93-103.  25460514
      • Gao F, Thompson JR, Petsios E, Erkenbrack E, Moats RA, Bottjer DJ, Davidson EH  (2015)  Juvenile skeletogenesis in anciently diverged sea urchin clades.  Dev Biol  none  25641694
      • Stepicheva NA, Song JL  (2015)  microRNA-31 modulates skeletal patterning in the sea urchin embryo.  Development  142(21)3769-80.  26400092